Advertisement

Keratoendotheliitis Fugax Hereditaria: A Novel Cryopyrin-Associated Periodic Syndrome Caused by a Mutation in the Nucleotide-Binding Domain, Leucine-Rich Repeat Family, Pyrin Domain-Containing 3 (NLRP3) Gene

Open AccessPublished:January 21, 2018DOI:https://doi.org/10.1016/j.ajo.2018.01.017

      Purpose

      To describe the phenotype and the genetic defect in keratoendotheliitis fugax hereditaria, an autosomal dominant keratitis that periodically affects the corneal endothelium and stroma, leading in some patients to opacities and decreased visual acuity.

      Design

      Cross-sectional, hospital-based study.

      Methods

      Patient Population: Thirty affected and 7 unaffected subjects from 7 families, and 4 sporadic patients from Finland. Observation Procedures: Ophthalmic examination and photography, corneal topography, specular microscopy, and optical coherence tomography in 34 patients, whole exome sequencing in 10 patients, and Sanger sequencing in 34 patients. Main Outcome Measures: Clinical phenotype, disease-causing genetic variants.

      Results

      Unilateral attacks of keratoendotheliitis typically occurred 1-6 times a year (median, 2.5), starting at a median age of 11 years (range, 5-28 years), and lasted for 1-2 days. The attacks were characterized by cornea pseudoguttata and haze in the posterior corneal stroma, sometimes with a mild anterior chamber reaction, and got milder and less frequent in middle age. Seventeen (50%) patients had bilateral stromal opacities. The disease was inherited as an autosomal dominant trait. A likely pathogenic variant c.61G>C in the NLRP3 gene, encoding cryopyrin, was detected in all 34 tested patients and segregated with the disease. This variant is present in both Finnish and non-Finnish European populations at a frequency of about 0.02% and 0.01%, respectively.

      Conclusion

      Keratoendotheliitis fugax hereditaria is an autoinflammatory cryopyrin-associated periodic syndrome caused by a missense mutation c.61G>C in exon 1 of NLRP3 in Finnish patients. It is additionally expected to occur in other populations of European descent.
      Keratoendotheliitis fugax hereditaria (MIM 148200) is an autosomal dominant corneal disease that periodically, and fleetingly, affects the corneal endothelium, stroma, and vision, eventually leading to central corneal stromal opacities in some patients. To the best of our knowledge, this disease was first described in 1964 as keratitis fugax hereditaria by the Finnish ophthalmologist Olavi Valle in a family with 10 affected members over 4 generations.
      • Valle O.
      Keratitis fugax hereditaria.
      • Valle O.
      Keratitis fugax hereditaria - a new eye syndrome.
      Two decades later, a second Finnish family with 21 affected members in 5 generations was reported, now highlighting transient corneal endothelial changes, and the term keratoendotheliitis fugax hereditaria was proposed.
      • Ruusuvaara P.
      • Setälä K.
      Keratoendotheliitis fugax hereditaria. A clinical and specular microscopic study of a family with dominant inflammatory corneal disease.
      Keratoendotheliitis in general is recognized in association with different types of viral keratitis
      • Inoue Y.
      Review of clinical and basic approaches to corneal endotheliitis.
      and it also can occur as an idiopathic sporadic finding,
      • Sutcliffe E.
      • Baum J.
      Acute idiopathic corneal endotheliitis.
      • Paul R.H.
      Presumed autoimmune corneal endotheliopathy.
      • Rao B.V.
      • Joshi D.S.
      • Gupta S.
      • Moulick P.S.
      Management of recurrent acute bilateral corneal endotheliitis monitored by serial corneal pachymetry.
      but we are unaware of any other reports of familial keratoendotheliitis.
      The disease is characterized by unilateral attacks of ocular pain, pericorneal injection, and photophobia. Slit-lamp examination of the cornea reveals transiently edematous endothelial cells (cornea pseudoguttata), mildly edematous stroma, and, occasionally, a mild anterior chamber reaction.
      • Ruusuvaara P.
      • Setälä K.
      Keratoendotheliitis fugax hereditaria. A clinical and specular microscopic study of a family with dominant inflammatory corneal disease.
      Corneal specular endothelial microscopy shows large “black holes” typical of cornea pseudoguttata. The corneal thickness is slightly increased during the attack.
      • Ruusuvaara P.
      • Setälä K.
      Keratoendotheliitis fugax hereditaria. A clinical and specular microscopic study of a family with dominant inflammatory corneal disease.
      Topical corticosteroids and nonsteroidal anti-inflammatory drugs (NSAID) have provided some relief. The acute symptoms vanish in 1-2 days but vision remains blurry for several weeks. The attacks start at the age of 3-12 years and can affect either eye. They generally decrease in frequency and get milder with age.
      • Valle O.
      Keratitis fugax hereditaria - a new eye syndrome.
      • Ruusuvaara P.
      • Setälä K.
      Keratoendotheliitis fugax hereditaria. A clinical and specular microscopic study of a family with dominant inflammatory corneal disease.
      Oval central stromal opacities may develop, compromising vision to some extent in older patients.
      • Ruusuvaara P.
      • Setälä K.
      Keratoendotheliitis fugax hereditaria. A clinical and specular microscopic study of a family with dominant inflammatory corneal disease.
      We refine here the phenotypic spectrum of keratoendotheliitis fugax hereditaria based on examination of 4 sporadic patients and 30 affected members from 7 families from Finland, including a previously reported family.
      • Ruusuvaara P.
      • Setälä K.
      Keratoendotheliitis fugax hereditaria. A clinical and specular microscopic study of a family with dominant inflammatory corneal disease.
      We provide evidence that a missense variant, identified by exome-wide genetic analysis in the nucleotide-binding domain, leucine-rich repeat (NLR) family, pyrin domain-containing 3 (NLRP3) gene likely is the cause of keratoendotheliitis fugax hereditaria in all Finnish patients studied.

      Methods

       Patients

      Eligible for this genetic and observational cohort study were patients who had typical symptoms and signs of keratoendotheliitis fugax hereditaria with or without family history, and who were clinically diagnosed between 3rd of April 2016 and 30th of June 2017 at the Eye Casualty Emergency Service or the Anterior Segment Surgical Service, Department of Ophthalmology, Helsinki University Hospital, Finland. The study was cross-sectional. We approached the families of each index patient to determine if typical symptoms were present in other family members. In addition to family KEF1, which has previously been reported,
      • Ruusuvaara P.
      • Setälä K.
      Keratoendotheliitis fugax hereditaria. A clinical and specular microscopic study of a family with dominant inflammatory corneal disease.
      we identified 6 new ones, studied 30 affected family members from them, and diagnosed 4 new sporadic patients who all fulfilled the inclusion criteria (Table). All pedigrees were consistent with autosomal dominant inheritance (Figure 1).
      TableCharacteristics of 34 Patients With Keratoendotheliitis Fugax Hereditaria
      FamilyPatientSexPatient-reportedAge (y)BCVA, OD - OSCorneal AbnormalitiesOther Diseases
      Age of Onset (y)Annual Recurrences
      KEF1
      Reported previously by Ruusuvaara and Setälä.3
      1-01M1234320/12.5 - 20/12.5Central oval opacity, bilateralNone
      1-02F72-36820/20 - 20/20Modest EBMDPseudophakia, epiretinal membrane
      1-03M1033120/16 - 20/20NoneAddison disease, hypothyreosis
      1-04M10-121-26920/32 - 20/50Central oval opacity, bilateralRetinal detachment
      1-05M14-151-23820/16 - 20/16Central oval opacity, faint bilateralHarlequin syndrome
      1-06F13-141-24220/20 - 20/25Central oval opacity, faint bilateralAsthma, atopy
      1-07F11-131-36520/63 - 20/50Central oval opacity, bilateralDyslipidemia, pollen allergy
      1-08M14-152-46420/16 - 20/16Central crocodile shagreenNone
      KEF22-01F10-111-65920/12.5 - 20/16Central oval opacity, bilateralAsthma, juvenile artrithis
      Seronegative antinuclear-positive juvenile idiopathic arthritis in Patient 2-07; we do not have specific information on her mother, Patient 2-01.
      2-02F7-1233220/25 - 20/20NoneBladder carcinoma
      2-03M111-24520/50 - 20/50Central oval opacity, bilateralCentral serous chorioretinopathy
      2-04F10-1427520/16 - 20/20NoneHypothyreosis, trochlear palsy, pseudophakia, epiretinal membrane
      2-05F7-102-31920/12.5 - 20/12.5NoneNone
      2-06F282-34720/16 - 20/16NoneAtopy, pollen allergy
      2-07F5-74-52720/25 - 20/32Central opacity, faintJuvenile arthritis
      Seronegative antinuclear-positive juvenile idiopathic arthritis in Patient 2-07; we do not have specific information on her mother, Patient 2-01.
      2-08M220-12220/12.5 - 20/10NoneNone
      KEF33-01F122-36320/20 - 20/25NoneGraves disease
      3-02M7NA4520/100 - 20/125Central oval opacity, bilateralNone
      3-03F63-52020/25 - 20/200NoneNone
      KEF44-01M8-1213020/32 - 20/20Central oval opacity, faint bilateralNone
      KEF55-01F8-122-55120/25 - 20/20NoneCerebral aneurysm
      KEF66-01F202-45120/16 - 20/16Opacity, faintNone
      6-02M8-1242220/16 - 20/16NoneNone
      6-03M16-170-27420/40 - 20/32Central opacity, faintSenile cataract, polymyalgia rheumatica
      KEF77-01M173-44620/25 - 20/16Central oval opacity, bilateralNone
      7-03F270-13120/20 - 20/20NoneNone
      7-04MNANA6720/20 - 20/20NoneMantle cell lymphoma, cholangiocarcinoma
      7-05F10-113-41820/16 - 20/16NoneAtopy
      KEF88-01F15-1622320/16 - 20/16Central opacity, faintNone
      KEF99-01F114-64720/20 - 20/16Central opacity, faintNone
      KEF1010-01M8-91-42620/20 - 20/20Central oval opacity, bilateralNone
      KEF1212-01M7-93-46720/32 - 20/32Central oval opacity, bilateralAtopy, pollen allergy
      12-02F8-120-43620/16 - 20/16NoneNone
      12-03M1023820/25 - 20/20NoneNone
      BCVA = best-corrected visual acuity; EBMD = epithelial basement membrane dystrophy.
      a Reported previously by Ruusuvaara and Setälä.
      • Ruusuvaara P.
      • Setälä K.
      Keratoendotheliitis fugax hereditaria. A clinical and specular microscopic study of a family with dominant inflammatory corneal disease.
      b Seronegative antinuclear-positive juvenile idiopathic arthritis in Patient 2-07; we do not have specific information on her mother, Patient 2-01.
      Figure thumbnail gr1
      Figure 1Pedigrees of 7 families with keratoendotheliitis fugax hereditaria and the sequence chromatogram of the c.61G>C variant (arrow) in NLRP3. Patients with an ID number were studied; the + indicates presence and – absence of the variant.
      The study was approved by the institutional review board of the Operative Section of the Helsinki University Hospital and followed the tenets of the Declaration of Helsinki. Written informed consent was obtained from all participants.

       Clinical Examination

      We collected a detailed medical and family history, and performed a comprehensive ophthalmic examination (J.A.T.) for 34 affected and 7 nonaffected, consenting subjects. We also performed anterior segment photography, noncontact specular microscopy (EM-3000; Tomey Co, Nagoya, Japan), corneal topography, and Fourier-domain, swept source anterior segment optical coherence tomography (SS-1000 CASIA; Tomey Co).

       Whole-Exome Sequencing

      We collected DNA from 34 affected patients and 7 nonaffected family members for genetic analyses. Genomic DNA was extracted from peripheral blood using standard methods. Six individuals (Patients 1-01, 1-03, 2-01, 2-03, 2-05, and 3-02; Figure 1) from 3 different families were analyzed by whole-exome sequencing (WES) at the Institute for Molecular Medicine Finland (FIMM, Helsinki, Finland). A NimbleGen Exome v2 kit (Roche, San Diego, California, USA) and an Agilent SureSelect Clinical Research Exome kit (Agilent Technologies, Santa Clara, California, USA) were used for library preparation. Library quantification was performed using a 2100 Bioanalyzer High Sensitivity kit (Agilent). The libraries were enriched with SeqCap EZ Human Exome Kit v2.0. Exome capture was performed using the HiSeq 2500 platform (Illumina, San Diego, California, USA). Sequence reads were processed and aligned to the human reference genome hg19 (GRCh37) as previously described, with minor modifications.
      • Sulonen A.M.
      • Ellonen P.
      • Almusa H.
      • et al.
      Comparison of solution-based exome capture methods for next generation sequencing.
      Single nucleotide variants and indels were called using SAMtools5 (version 1.2) as described previously.
      • Sulonen A.M.
      • Ellonen P.
      • Almusa H.
      • et al.
      Comparison of solution-based exome capture methods for next generation sequencing.
      Four additional individuals (Patients 1-02, 1-05, 2-04, and 2-07) from 2 families underwent WES at Blueprint Genetics (Helsinki, Finland). The SureSelect Human All Exome V6 kit (Agilent) was used for exome capture and sequencing was performed at the BGI (formerly known as Beijing Genomics Institute, Hong Kong) using the HiSeq 4000 platform (Illumina). Sequence reads were aligned to the human reference genome hg19 (GRCh37) using Burrows-Wheeler Aligner.
      • Li H.
      • Durbin R.
      Fast and accurate short read alignment with Burrows-Wheeler transform.
      Variants were called using GATK HaplotypeCaller.
      • McKenna A.
      • Hanna M.
      • Banks E.
      • et al.
      The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data.
      Variants were annotated using ANNOVAR,
      • Wang K.
      • Li M.
      • Hakonarson H.
      ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data.
      which was implemented in the VarAFT 2.06 (http://varaft.eu). Annotated variants were filtered using VarAFT to include exonic and conserved splice site variants with a consequence of missense or more severe mutation, and a minor allele frequency (MAF) of 0.1% or lower in the Exome Aggregation Consortium (ExAC, Cambridge, Massachusetts, USA
      • Lek M.
      • Karczewski K.J.
      • Minikel E.V.
      • et al.
      Analysis of protein-coding genetic variation in 60,706 humans.
      ). Aligned data were visualized with the Integrated Genomics Viewer (Broad Institute, Boston, Massachusetts, USA).
      • Robinson J.T.
      • Thorvaldsdottir H.
      • Winckler W.
      • et al.
      Integrative genomics viewer.

       Sanger Sequencing and Variant Analysis

      The NLRP3 variant c.61G>C (rs200154873; GenBank: NM_004895.4) was confirmed by Sanger sequencing in the individuals analyzed with WES and in the rest of the family members. Sequencing was done from polymerase chain reaction (PCR)-amplified DNA (primer sequences for forward AAAAGACTCATCCGTGTGCCG and reverse GTCTTCCTTCCACTCACCCCA) using conventional methodologies. Sequences were analyzed with the Sequencher 5.3 program (Genes Codes Corporation, Ann Arbor, Michigan, USA). Variant allele frequencies were determined using the ExAC v. 0.3.1 database,
      • Lek M.
      • Karczewski K.J.
      • Minikel E.V.
      • et al.
      Analysis of protein-coding genetic variation in 60,706 humans.
      the 1000 Genomes Project database,
      • Auton A.
      • Brooks L.D.
      • et al.
      1000 Genomes Project Consortium
      A global reference for human genetic variation.
      and the Sequencing Initiative Suomi project (http://sisuproject.fi, SISu v4.1; accessed February, 2017). In silico predictions regarding protein function were performed with PolyPhen2,
      • Adzhubei I.A.
      • Schmidt S.
      • Peshkin L.
      • et al.
      A method and server for predicting damaging missense mutations.
      SIFT,
      • Sim N.L.
      • Kumar P.
      • Hu J.
      • Henikoff S.
      • Schneider G.
      • Ng P.C.
      SIFT web server: predicting effects of amino acid substitutions on proteins.
      MutationTaster,
      • Schwarz J.M.
      • Cooper D.N.
      • Schuelke M.
      • Seelow D.
      MutationTaster2: mutation prediction for the deep-sequencing age.
      and CADD.
      • Kircher M.
      • Witten D.M.
      • Jain P.
      • O'Roak B.J.
      • Cooper G.M.
      • Shendure J.
      A general framework for estimating the relative pathogenicity of human genetic variants.
      An analysis of conservation of sequences was made with MutationTaster, which uses for alignment the BLAST blastp suite.
      • Altschul S.F.
      • Gish W.
      • Miller W.
      • Myers E.W.
      • Lipman D.J.
      Basic local alignment search tool.

      Results

       Clinical Phenotype

      We examined 18 affected female patients and 16 male patients with a median age of 43 years (range, 18-75 years). All individuals reported repeated unilateral attacks of keratoendotheliitis typically 1-6 (median, 2.5) times per year, starting at the median age of 11 years (range, 5-28 years; Table). Attacks got milder in middle age, and their frequency decreased. No seasonal variation was evident, based on interview. The symptoms were conjunctival injection, pain, and photophobia. Sometimes the attack was associated with a mild anterior chamber reaction. These symptoms resolved in 1-2 days. Blurred vision could last for several weeks. The patients often treated their attacks with a topical corticosteroid or NSAID a few times a day for 1-7 days. Some patients reported that attacks were milder if they started treatment early, and 2 found that an oral NSAID worked best for them.
      Cornea pseudoguttata, thought to correspond to patchy transient corneal endothelial edema,
      • Krachmer J.H.
      • Schnitzer J.I.
      • Fratkin J.
      Cornea pseudoguttata: a clinical and histopathologic description of endothelial cell edema.
      • Nakashima Y.
      • Yoshitomi F.
      • Oshika T.
      Clinical evaluation of cornea pseudoguttata.
      was observed during an acute attack, but all patients had normal endothelium by biomicroscopy between attacks. The features of acute keratoendotheliitis on day 1 are presented for Patient 4-01, a sporadic case. His left eye showed pseudoguttata and haze in the posterior corneal stroma (Figure 2, Top). Mild anterior chamber reaction was noted. Corneal thickness was slightly larger than in his fellow eye (Figure 2, Middle). Specular microscopy confirmed cornea pseudoguttata in the symptomatic eye only (Figure 2, Bottom). At least 1 acute attack was associated with a mild anterior chamber reaction in 41% of patients, based on available patient charts. The attack was sometimes incorrectly diagnosed and treated as an acute anterior uveitis. The intraocular pressure remained normal and was comparable with that of the uninvolved fellow eye. Best-corrected visual acuity (BCVA) transiently deteriorated during the attack. Some patients reported, and their charts documented, occasional corneal erosions, but none were observed during our cross-sectional study.
      Figure thumbnail gr2
      Figure 2Acute keratoendotheliitis attack of Patient 4-01 with the c.61G>C variant in NLRP3. (Top) Cloudiness and small deposits in corneal stroma. (Middle left) Corneal topography of the uninvolved right eye. (Middle right) Corneal topography of the affected left eye showing modest thickening of the cornea relative to the fellow eye. (Bottom left) Specular microscopy of the cornea of the uninvolved eye with normal endothelium during the attack. (Bottom right) Specular microscopy of cornea pseudoguttata during an acute attack (transiently edematous endothelial cells appear as “black holes”).
      Eight patients (24%) had faint and 9 (26%) had definite central, horizontally oval, typically bilateral stromal opacities after repeated attacks (Figure 3). Four of the 8 patients with faint opacities (including 1 with bilateral cataracts) and 6 of the 9 patients with definite opacities had decreased BCVA in at least 1 eye, attributed to the opacities. One patient had coincident epithelial basement membrane dystrophy, and 1 displayed central crocodile shagreen (Table). None had undergone corneal surgical procedures. The median age of the 17 patients with clear corneas between attacks was 34 years (range, 18-75 years) as compared to 40 years (range, 23-74 years) for those with faint and 46 years (range, 26-69 years) for those with definite central opacities. Their median BCVA was 20/20, 20/20, and 20/32, respectively. Three patients with central opacities attained better visual acuity with rigid contact lenses as compared to spectacles.
      Figure thumbnail gr3
      Figure 3The spectrum of definite corneal stromal opacities in the right and left eye of 5 patients with keratoendotheliitis fugax hereditaria from the c.61G>C variant in NLRP3. (Top row, right and left) Patient 1-01 (aged 43 years, best-corrected visual acuity [BCVA] 20/12.5). (Second row, right and left) Patient 1-04 (aged 69 years, BCVA 20/32 and 20/50). (Third row, right and left) Patient 3-02 (aged 45 years, BCVA 20/100 and 20/125). (Fourth row, right and left) Patient 7-01 (aged 46 years, BCVA 20/25 and 20/16). (Bottom row, right and left) Patient 10-01 (aged 26 years, VA 20/20). Vertical striae in bottom row, right and left are considered to be coincidental findings.
      Between attacks, anterior segment optical coherence tomography did not reveal substantial changes other than the stromal scars in patients who had clinically detectable stromal opacities (Figure 4). Similarly, corneal topography did not show any abnormalities (data not shown). Specular microscopic images and counts of endothelial cells likewise were considered normal for age between attacks (data not shown).
      Figure thumbnail gr4
      Figure 4Anterior segment optical coherence tomography of definite corneal stromal opacities in the right and left cornea of 2 patients with keratoendotheliitis fugax hereditaria from the c.61G>C variant in NLRP3. (Top, left and right) Moderately increased signal intensity in the central cornea of Patient 1-04 (aged 69 years, best-corrected visual acuity [BCVA] 20/32 and 20/50, compare with , Second row, right and left). (Bottom, right and left) High signal intensity extending toward midperipheral cornea in Patient 3-02 (aged 45 years, BCVA 20/100 and 20/125, compare with , Third row, right and left).
      The patients had no consistent systemic associations, although 2 patients in 1 family had a history of juvenile arthritis (Table).

       Whole-Exome Sequence Analysis of 10 Patients

      Given the apparent autosomal dominant inheritance pattern, we assumed that any causal variant would likely be present in the heterozygous state and shared between related affected individuals. Given the rarity of the disease, we assumed that the variant would have an MAF below 0.1% in the exome databases.
      • Lek M.
      • Karczewski K.J.
      • Minikel E.V.
      • et al.
      Analysis of protein-coding genetic variation in 60,706 humans.
      • Auton A.
      • Brooks L.D.
      • et al.
      1000 Genomes Project Consortium
      A global reference for human genetic variation.
      Initially, we assumed that all affected individuals probably had a mutation in the same gene, although not necessarily the same variant. We searched for loss of function, conserved splice site, and nonsynonymous variants.
      We performed WES for 10 affected individuals from 3 families. After filtering according to the criteria above, 2 candidate genes remained: NLR family, pyrin domain-containing 3 (NLRP3: NM_004895.4), and zinc finger protein 806 (ZNF806: NM_001137674). The exact function of ZNF806 is unknown and it harbored many potentially pathogenic variants in every sequenced individual (data not shown). Therefore, it was unlikely to be the causative gene, whereas all 10 affected individuals had the same nonsynonymous variant c.61G>C in NLRP3.

       Sanger Sequencing of the c.61G>C Variant in NLRP3

      We confirmed the presence of the c.61G>C variant in NLRP3 by bidirectional Sanger sequencing in each of the 10 patients subjected to WES. We next sequenced all consenting family members of the 3 families, additional affected individuals from the other families, and the 4 sporadic patients, and confirmed that all 34 patients with clinically diagnosed keratoendotheliitis fugax hereditaria had the c.61G>C variant. To confirm segregation, we tested 7 nonaffected members from 3 families, and none of them carried the c.61G>C variant.
      The variant c.61G>C is located in exon 1 in NLRP3 (Figure 5) and leads to substitution of histidine for aspartic acid at position 21 in the encoded protein (p.Asp21His). Multiple prediction programs predicted it to be pathogenic (Polyphen2, probably damaging; SIFT, deleterious; MutationTaster, disease causing, scaled-CADD score 18.4). The aspartic acid residue is highly conserved across species, supporting the pathogenic effect of this variant (Figure 5). Moreover, whereas aspartic acid is negatively charged, histidine in contrast is partially positively charged at physiological pH. As expected from the filtering strategy, c.61G>C is a rare variant: 2 heterozygous Finnish individuals are listed in the SISu database (MAF, 0.023%; 8591 individuals, accessed September 2017) and 6 heterozygous individuals are found in aggregated non-Finnish European populations in the ExAC database (MAF, 0.0090%; 66 392 individuals, accessed September 2017). Other populations (African, Asian, and Latino; 8642 to 16 496 individuals each) did not have this variant in ExAC.
      Figure thumbnail gr5
      Figure 5The structure of the NLRP3 gene, the location of the c.61G>C variant, and conservation of the sequence between selected species. The domains of NLRP3 are the pyrin domain, the nucleoside triphosphatase (NTPase) domain (NACHT), and leucine-rich repeat (LRR) motifs. The aligment of NLRP3 amino acid sequences between species made using MutationTaster
      • Schwarz J.M.
      • Cooper D.N.
      • Schuelke M.
      • Seelow D.
      MutationTaster2: mutation prediction for the deep-sequencing age.
      are shown in the lower panel. Ptroglodytes = chimpanzee; Mmulatta = rhesus macaque; Fcatus = cat; Mmusculus = mouse. p.D21H is short form for p.Asp21His.

      Discussion

      Here we describe 30 patients from 7 families and 4 sporadic individuals affected with attacks of transient keratoendotheliitis who all have a heterozygous, dominantly inherited variant c.61G>C (p. Asp21His) in NLRP3, encoding cryopyrin. The predicted pathogenicity of this variant and high conservation of the affected amino acid combined with lack of the variant in healthy family members and its rarity in population databases strongly suggest that it is the mutation causing keratoendotheliitis fugax hereditaria in these patients. Moreover, NLRP3 mutations are known to cause monogenic autoinflammatory, cryopyrin-associated periodic syndromes (CAPS), the spectra of which include corneal phenotypes that overlap with that of keratoendotheliitis fugax hereditaria, further supporting the pathogenicity of the c.61G>C variant.
      • Dollfus H.
      • Hafner R.
      • Hofmann H.M.
      • et al.
      Chronic infantile neurological cutaneous and articular/neonatal onset multisystem inflammatory disease syndrome: ocular manifestations in a recently recognized chronic inflammatory disease of childhood.
      • Hawkins P.N.
      • Lachmann H.J.
      • Aganna E.
      • McDermott M.F.
      Spectrum of clinical features in Muckle-Wells syndrome and response to anakinra.
      • Espandar L.
      • Boehlke C.S.
      • Kelly M.P.
      First report of keratitis in familial cold autoinflammatory syndrome.
      NLRP3 is expressed predominantly in peripheral blood leukocytes
      • Hoffman H.M.
      • Mueller J.L.
      • Broide D.H.
      • Wanderer A.A.
      • Kolodner R.D.
      Mutation of a new gene encoding a putative pyrin-like protein causes familial cold autoinflammatory syndrome and Muckle-Wells syndrome.
      but also in corneal tissue, including the endothelium.
      • Bian F.
      • Xiao Y.
      • Zaheer M.
      • et al.
      Inhibition of NLRP3 inflammasome pathway by butyrate improves corneal wound healing in corneal alkali burn.
      • Oh J.Y.
      • Ko J.H.
      • Ryu J.S.
      • Lee H.J.
      • Kim M.K.
      • Wee W.R.
      Transcription profiling of NOD-like receptors in the human cornea with disease.
      Cryopyrin is a member of the NLR family of proteins that are involved in the immune system
      • Mason D.R.
      • Beck P.L.
      • Muruve D.A.
      Nucleotide-binding oligomerization domain-like receptors and inflammasomes in the pathogenesis of non-microbial inflammation and diseases.
      and that regulate responses to different environmental triggers. Together with other proteins, they form inflammasomes that activate inflammatory processes. Clinically, keratoendotheliitis fugax hereditaria appears to be an inflammatory attack that affects the endothelium and posterior stroma of the cornea, further supporting that the NLRP3 variant that our patients share is the likely cause of this disease.
      Other autosomal dominant pathogenic variants in NLRP3 are known to cause 3 CAPS in humans: familial cold autoinflammatory syndrome (FCAS1, MIM 120100),
      • Espandar L.
      • Boehlke C.S.
      • Kelly M.P.
      First report of keratitis in familial cold autoinflammatory syndrome.
      Muckle-Wells syndrome (MWS, MIM 191900),
      • Hawkins P.N.
      • Lachmann H.J.
      • Aganna E.
      • McDermott M.F.
      Spectrum of clinical features in Muckle-Wells syndrome and response to anakinra.
      and chronic infantile neurological cutaneous articular syndrome (CINCA, MIM 607115), also known as neonatal-onset multisystem inflammatory disease.
      • Dollfus H.
      • Hafner R.
      • Hofmann H.M.
      • et al.
      Chronic infantile neurological cutaneous and articular/neonatal onset multisystem inflammatory disease syndrome: ocular manifestations in a recently recognized chronic inflammatory disease of childhood.
      These diseases belong to monogenic autoinflammatory syndromes that are caused by aberrant inflammasome activation and are characterized by episodic fevers, skin rashes, conjunctivitis, stomatitis, and inflammation of joints, gastrointestinal tract, and the nervous system.
      • Caso F.
      • Rigante D.
      • Vitale A.
      • et al.
      Monogenic autoinflammatory syndromes: state of the art on genetic, clinical, and therapeutic issues.
      They also emerge generally during childhood. We suggest that keratoendotheliitis fugax hereditaria is the fourth member in the family of NLRP3-associated periodic autoinflammatory syndromes.
      The NLRP3 variants responsible for the previously known CAPS are located predominantly in exon 3. Currently, 189 variants in this gene are listed in Infevers, an on-line registry of hereditary autoinflammatory disorder mutations.
      • Milhavet F.
      • Cuisset L.
      • Hoffman H.M.
      • et al.
      The infevers autoinflammatory mutation online registry: update with new genes and functions.
      Although 5 previously known variants involve exon 1, they are not listed as being associated with keratitis. However, patients with FCAS1 may have ocular pain, photophobia, keratitis, and anterior uveitis
      • Espandar L.
      • Boehlke C.S.
      • Kelly M.P.
      First report of keratitis in familial cold autoinflammatory syndrome.
      ; conjunctivitis and chronic keratitis are reported in MWS
      • Hawkins P.N.
      • Lachmann H.J.
      • Aganna E.
      • McDermott M.F.
      Spectrum of clinical features in Muckle-Wells syndrome and response to anakinra.
      • Gorovoy I.R.
      • Gorovoy J.B.
      • Salomao D.
      • Gorovoy M.S.
      Chronic keratitis with intrastromal epithelioid histiocytes: a new finding in Muckle-Wells syndrome.
      ; and conjunctivitis, corneal opacities, band keratopathy, anterior uveitis, vitritis, retinal vasculitis, and optic disc abnormalities occur in CINCA.
      • Dollfus H.
      • Hafner R.
      • Hofmann H.M.
      • et al.
      Chronic infantile neurological cutaneous and articular/neonatal onset multisystem inflammatory disease syndrome: ocular manifestations in a recently recognized chronic inflammatory disease of childhood.
      Our patients did not have a history consistent with any of these autoinflammatory diseases, but the ocular symptoms and signs in the three previously known CAPS overlap with those of keratoendotheliitis fugax hereditaria, in which the presumed autoinflammatory reaction appears to be restricted, or predominantly directed, to the anterior segment of the eye. Alternatively, keratoendotheliitis fugax hereditaria may be a mild form of CAPS in which systemic involvement remains subclinical and only the eye is sensitive enough to give rise to symptoms.
      Various extrinsic stimuli, including infections, upregulate corneal NLRP3 in vitro.
      • Bian F.
      • Xiao Y.
      • Zaheer M.
      • et al.
      Inhibition of NLRP3 inflammasome pathway by butyrate improves corneal wound healing in corneal alkali burn.
      • Oh J.Y.
      • Ko J.H.
      • Ryu J.S.
      • Lee H.J.
      • Kim M.K.
      • Wee W.R.
      Transcription profiling of NOD-like receptors in the human cornea with disease.
      The p.Asp21His amino acid substitution in our patients is localized in the pyrin-like domain (PYD) of cryopyrin. Upon activation, NLRP3 recruits through PYD/PYD interactions the apoptosis-associated speck-like protein that contains a caspase-recruitment domain (ASC).
      • Masumoto J.
      • Taniguchi S.
      • Nakayama J.
      • et al.
      Expression of apoptosis-associated speck-like protein containing a caspase recruitment domain, a pyrin N-terminal homology domain-containing protein, in normal human tissues.
      The ASC domain in turn recruits caspase-1
      • Lu A.
      • Magupalli V.G.
      • Ruan J.
      • et al.
      Unified polymerization mechanism for the assembly of ASC-dependent inflammasomes.
      , which activates interleukin-1β (IL-1β) and IL-18. Some pathogenic NLRP3 variants also are activating and lead to overproduction of IL-1. The p.Asp21His substitution also might be an activating one that upregulates the ASC pathway through the mutated PYD domain of cryopyrin, but this remains to be studied.
      Currently, no specific treatment is known for keratoendotheliitis fugax hereditaria, although several patients felt that a topical corticosteroid or NSAID started early was beneficial, and some found relief from an oral NSAID. As regards ocular manifestations in the 3 systemic forms of CAPS, a girl with periodic fever from exon 3 mutation in NLRP3 had developed, by the age of 9 years, iritis and central oval corneal opacities resembling those of our older patients.
      • Tsatsos M.
      • Hawkin P.N.
      • Hossain P.
      Corneal response to canakinumab in cryopyrin associated periodic fever syndrome.
      Her opacities resolved within 6 months after administration of canakinumab, an anti-IL-1β monoclonal antibody. In a more severely affected 8-year-old girl with MWS, anterior corneal opacities and optic disc edema resolved with anakinra, an IL-1 receptor antagonist.
      • Terrada C.
      • Neven B.
      • Boddaert N.
      • et al.
      Ocular modifications in a young girl with cryopyrin-associated periodic syndromes responding to interleukin-1 receptor antagonist anakinra.
      In other patients with autoinflammatory syndromes from NLRP3 mutations, rilonacept, an IL-1 trap, is considered appropriate treatment.
      • Bascherini V.
      • Granato C.
      • Lopalco G.
      • et al.
      The protean ocular involvement in monogenic autoinflammatory diseases: state of the art.
      • Landmann E.C.
      • Walker U.A.
      Pharmacological treatment options for cryopyrin-associated periodic syndromes.
      These reports suggest that the stromal opacities that caused reduced vision in some older patients with keratoendotheliitis fugax hereditaria also might be pharmacologically modifiable infiltrates.
      The limitations of our research currently include lack of histopathologic data of corneal opacities to characterize their nature, because none have been treated surgically, and pending functional analysis of the c.61G>C variant. We are confident, however, that our findings so far will be helpful in bringing this corneal disease to wider attention, and expect that testing for NLRP3 mutations will lead to diagnosis of keratoendotheliitis fugax hereditaria in other countries. This will help to chart the full phenotypic variability of this disease and may lead to identification of additional NLRP3 variants that might cause keratoendotheliitis fugax hereditaria. What triggers the acute attacks, why some patients have fewer and milder attacks, whether or not some patients also have mild systemic manifestations, and whether treatment with IL-1 inhibitors will resolve the stromal opacities are questions that still remain to be answered. At present, keratoendotheliitis fugax hereditaria can be viewed as a CAPS with restricted ocular signs and symptoms within the larger monogenic autoinflammatory disease spectrum.
      To the best of our knowledge, no reports of keratoendotheliitis fugax hereditaria outside the Finnish population exist. Given that the c.61G>C variant is found in 6 individuals from non-Finnish European populations in the ExAC database
      • Lek M.
      • Karczewski K.J.
      • Minikel E.V.
      • et al.
      Analysis of protein-coding genetic variation in 60,706 humans.
      with a MAF of approximately 0.01% (1:10 000), we suspect that this disease also affects other populations of European origin. One reason why keratoendotheliitis fugax hereditaria so far has not been more widely recognized is that some patients have mild acute attacks that are mostly not severe enough to bring them to the eye casualty unit. The stromal opacities in older patients might also be confused with sequelae of more common corneal disorders. We identified several new patients by maintaining a high index of suspicion and by pursuing a history of prior attacks and a family history. If patients are not seen during the first 1-2 days of the attack, their corneal findings may be missed and sporadic cases may be misdiagnosed as mild anterior uveitis. The relatively high MAF suggests that even in Finland the diagnosis often is missed.
      Funding/Support: The Eye and Tissue Bank Foundation, Helsinki, Finland; the Folkhälsan Research Foundation, Helsinki, Finland; the Finnish Ophthalmological Society, Helsinki Finland; and the Eye Foundation, Helsinki, Finland. Financial Disclosures: Joni A. Turunen received lecture fees from Thea Finland. Tero T. Kivelä received lecture fees from Santen Finland. The following authors have no financial disclosures: Juho Wedenoja, Pauliina Repo, Reetta-Stiina Järvinen, Johannes E. Jäntti, Sanna Mörtenhumer, Antti S. Riikonen, Anna-Elina Lehesjoki, and Anna Majander. The authors attest that they meet the current ICMJE criteria for authorship.

      Supplemental Data

      Figure thumbnail figs1
      Joni A. Turunen, is a consultant ophthalmologist and a group leader in the department of ophthalmology at the Helsinki University Hospital and Folkhälsan Research Center at Helsinki, Finland. Dr. Turunen received his MD, PhD and ophthalmogist degree from the University of Helsinki. He is currently working as an ophthalmogeneticist and his research is focused on the monogenic diseases of the eye.

      References

        • Valle O.
        Keratitis fugax hereditaria.
        Duodecim. 1964; 80: 659-664
        • Valle O.
        Keratitis fugax hereditaria - a new eye syndrome.
        Ophthalmologica. 1966; 151: 537-547
        • Ruusuvaara P.
        • Setälä K.
        Keratoendotheliitis fugax hereditaria. A clinical and specular microscopic study of a family with dominant inflammatory corneal disease.
        Acta Ophthalmol (Copenh). 1987; 65: 159-169
        • Inoue Y.
        Review of clinical and basic approaches to corneal endotheliitis.
        Cornea. 2014; 33: S3-8
        • Sutcliffe E.
        • Baum J.
        Acute idiopathic corneal endotheliitis.
        Ophthalmology. 1984; 91: 1161-1165
        • Paul R.H.
        Presumed autoimmune corneal endotheliopathy.
        Am J Ophthalmol. 1988; 105: 519-522
        • Rao B.V.
        • Joshi D.S.
        • Gupta S.
        • Moulick P.S.
        Management of recurrent acute bilateral corneal endotheliitis monitored by serial corneal pachymetry.
        Med J Armed Forces India. 2016; 72: S108-S110
        • Sulonen A.M.
        • Ellonen P.
        • Almusa H.
        • et al.
        Comparison of solution-based exome capture methods for next generation sequencing.
        Genome Biol. 2011; 12: R94
        • Li H.
        • Durbin R.
        Fast and accurate short read alignment with Burrows-Wheeler transform.
        Bioinformatics. 2009; 25: 1754-1760
        • McKenna A.
        • Hanna M.
        • Banks E.
        • et al.
        The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data.
        Genome Res. 2010; 20: 1297-1303
        • Wang K.
        • Li M.
        • Hakonarson H.
        ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data.
        Nucleic Acids Res. 2010; 38: e164
        • Lek M.
        • Karczewski K.J.
        • Minikel E.V.
        • et al.
        Analysis of protein-coding genetic variation in 60,706 humans.
        Nature. 2016; 536: 285-291
        • Robinson J.T.
        • Thorvaldsdottir H.
        • Winckler W.
        • et al.
        Integrative genomics viewer.
        Nat Biotechnol. 2011; 29: 24-26
        • Auton A.
        • Brooks L.D.
        • et al.
        • 1000 Genomes Project Consortium
        A global reference for human genetic variation.
        Nature. 2015; 526: 68-74
        • Adzhubei I.A.
        • Schmidt S.
        • Peshkin L.
        • et al.
        A method and server for predicting damaging missense mutations.
        Nat Methods. 2010; 7: 248-249
        • Sim N.L.
        • Kumar P.
        • Hu J.
        • Henikoff S.
        • Schneider G.
        • Ng P.C.
        SIFT web server: predicting effects of amino acid substitutions on proteins.
        Nucleic Acids Res. 2012; 40: W452-457
        • Schwarz J.M.
        • Cooper D.N.
        • Schuelke M.
        • Seelow D.
        MutationTaster2: mutation prediction for the deep-sequencing age.
        Nat Methods. 2014; 11: 361-362
        • Kircher M.
        • Witten D.M.
        • Jain P.
        • O'Roak B.J.
        • Cooper G.M.
        • Shendure J.
        A general framework for estimating the relative pathogenicity of human genetic variants.
        Nat Genet. 2014; 46: 310-315
        • Altschul S.F.
        • Gish W.
        • Miller W.
        • Myers E.W.
        • Lipman D.J.
        Basic local alignment search tool.
        J Mol Biol. 1990; 215: 403-410
        • Krachmer J.H.
        • Schnitzer J.I.
        • Fratkin J.
        Cornea pseudoguttata: a clinical and histopathologic description of endothelial cell edema.
        Arch Ophthalmol. 1981; 99: 1377-1381
        • Nakashima Y.
        • Yoshitomi F.
        • Oshika T.
        Clinical evaluation of cornea pseudoguttata.
        Br J Ophthalmol. 2007; 91: 22-25
        • Dollfus H.
        • Hafner R.
        • Hofmann H.M.
        • et al.
        Chronic infantile neurological cutaneous and articular/neonatal onset multisystem inflammatory disease syndrome: ocular manifestations in a recently recognized chronic inflammatory disease of childhood.
        Arch Ophthalmol. 2000; 118: 1386-1392
        • Hawkins P.N.
        • Lachmann H.J.
        • Aganna E.
        • McDermott M.F.
        Spectrum of clinical features in Muckle-Wells syndrome and response to anakinra.
        Arthritis Rheum. 2004; 50: 607-612
        • Espandar L.
        • Boehlke C.S.
        • Kelly M.P.
        First report of keratitis in familial cold autoinflammatory syndrome.
        Can J Ophthalmol. 2014; 49: 304-306
        • Hoffman H.M.
        • Mueller J.L.
        • Broide D.H.
        • Wanderer A.A.
        • Kolodner R.D.
        Mutation of a new gene encoding a putative pyrin-like protein causes familial cold autoinflammatory syndrome and Muckle-Wells syndrome.
        Nat Genet. 2001; 29: 301-305
        • Bian F.
        • Xiao Y.
        • Zaheer M.
        • et al.
        Inhibition of NLRP3 inflammasome pathway by butyrate improves corneal wound healing in corneal alkali burn.
        Int J Mol Sci. 2017; 18: 562
        • Oh J.Y.
        • Ko J.H.
        • Ryu J.S.
        • Lee H.J.
        • Kim M.K.
        • Wee W.R.
        Transcription profiling of NOD-like receptors in the human cornea with disease.
        Ocul Immunol Inflamm. 2017; 25: 364-369
        • Mason D.R.
        • Beck P.L.
        • Muruve D.A.
        Nucleotide-binding oligomerization domain-like receptors and inflammasomes in the pathogenesis of non-microbial inflammation and diseases.
        J Innate Immun. 2012; 4: 16-30
        • Caso F.
        • Rigante D.
        • Vitale A.
        • et al.
        Monogenic autoinflammatory syndromes: state of the art on genetic, clinical, and therapeutic issues.
        Int J Rheumatol. 2013; 2013: 513782
        • Milhavet F.
        • Cuisset L.
        • Hoffman H.M.
        • et al.
        The infevers autoinflammatory mutation online registry: update with new genes and functions.
        Hum Mutat. 2008; 29: 803-808
        • Gorovoy I.R.
        • Gorovoy J.B.
        • Salomao D.
        • Gorovoy M.S.
        Chronic keratitis with intrastromal epithelioid histiocytes: a new finding in Muckle-Wells syndrome.
        Cornea. 2013; 32: 510-512
        • Masumoto J.
        • Taniguchi S.
        • Nakayama J.
        • et al.
        Expression of apoptosis-associated speck-like protein containing a caspase recruitment domain, a pyrin N-terminal homology domain-containing protein, in normal human tissues.
        J Histochem Cytochem. 2001; 49: 1269-1275
        • Lu A.
        • Magupalli V.G.
        • Ruan J.
        • et al.
        Unified polymerization mechanism for the assembly of ASC-dependent inflammasomes.
        Cell. 2014; 156: 1193-1206
        • Tsatsos M.
        • Hawkin P.N.
        • Hossain P.
        Corneal response to canakinumab in cryopyrin associated periodic fever syndrome.
        Br J Ophthalmol. 2013; 97: 1081-1082
        • Terrada C.
        • Neven B.
        • Boddaert N.
        • et al.
        Ocular modifications in a young girl with cryopyrin-associated periodic syndromes responding to interleukin-1 receptor antagonist anakinra.
        J Ophthalmic Inflamm Infect. 2011; 1: 133-136
        • Bascherini V.
        • Granato C.
        • Lopalco G.
        • et al.
        The protean ocular involvement in monogenic autoinflammatory diseases: state of the art.
        Clin Rheumatol. 2015; 34: 1171-1180
        • Landmann E.C.
        • Walker U.A.
        Pharmacological treatment options for cryopyrin-associated periodic syndromes.
        Expert Rev Clin Pharmacol. 2017; 10: 855-864